How not to save money in a laboratory
-
My fiance started working for a genetics laboratory last year and her role was advertised as assistant manager - since the previous manager left for greener pastures a while ago, the state of the laboratory was disorganized and part of her job would be fixing the mess.
But it quickly became apparent that the real source of dumbness and disorganization at the laboratory was not the lack of a manager, but the owners: The laboratory is owned by a couple in the early 70s which are genetic mediciners. Especially the female mediciner has a bipolor disorder and is a pain to work with, hence I will cal her ancient shedragon in the future.
The workflow SHOULD look like this: Somebody goes to the doctor, who sends a sample and a description of the symptoms to the lab. The lab recieves the sample, my fiance coordinates the analysis and the result is given to the mediciners who are adding medical expertise and sending it back the to doctor.
Unfortunately, the mediciners cannot resist to meddle with the lab, but have no leadership, business or genetic analysis skills.
Which leads to a plethora off wtfs, here are my favorites:
- The lab manager was fired because he tried to establish workflows, which was disliked by the owners because they felt they knew better how to run everything.
- Different symptoms require different analysis techniques but the wrong analysis was often ordered. My fiance tried to fix this, but was stalled by the ancient shedragon mediciner, because most of the errors where caused by her, and she disliked to be corrected. This costs a lot of money and time.
-The shedragon forbade talking in the lab because people need to work, not to talk. - They tried to hire a new secretary but the person hired was fired on day 3 because they disliked that she asked questions about her job and even talked to the lab to understand the workflow.
- Now the man tries to make office work, but he is a terrible secretary so a lot of deadlines are missed and customers are scared away.
- They have to save money, so my fiance was ordered to find replacements for lab equipment like gloves, which cost ~10€ per month. She was forced to spend a week on the issue.
- All work needs to be entered into home grown database which needs around a minute to process even the smallest change. My fiance often spends ~2 hours a day waiting on the database. For bonus wtf: the database backend is a filemaker database on a server.
- The computers are the best macs money can buy, but they refuse to spend money on new chairs, which is unfortunate because the chairs are so damaged that they are unstable.
-
Tell your fiance to run. Fast!
-
We try to run, but it is not that easy since germanys insurance reduced the budget for genetic analysis by 50%. Background: There was a loophole in a regulation which allowed it labs to sequence a whole chromosome but to claim money for every gene - some labs used that to rip off huge sums of money. So the insurances reacted and simply are not paying for next generation sequenching anymore. Now the labs are literally scraping the bottom of barrel to survive.
Ah, and its called next generation for a reason - but germany hates genes with a passion, so the public loves it when funding for genetic research is curtailed.
-
-
-
Forgive my ignorance, but what is a "mediciner"?
-
IIRC it's an unusual term for a Doc.
EDIT: specifically a physician, so not including the other things that are called doctors in standard english.
-
Sorry, I used mediciner - but the more accurate term would be medical specialist. In german the term would be "Facharzt für Humangenetik". I am unsure how to translate that - it's a doc specialized on genetic disorders. E.g.: If you are pregnant and there are anomalies in the ultrasound, you will be reffered to such a doc.
@aapis: We are in the process :D
-
The issue with genetics is basically green ideology: modifying genes is BAD because big pharma, nature is perfect and other weirdness-... YOu will find lots of produkts labeled "without genes" in a german supermarket, which is hilarious as hell.
-
'Facharzt' is a great word.
-
-
I am unsure how to translate that - it's a doc specialized on genetic disorders.
Probably “geneticist”. It's not accurate as it is really broader, but it's the term that's come to be used anyway. A bit like they'll say “chemist” to mean a pharmacist. (Fun fact: some pharmacists really do stock chemical supplies too.)
-
YOu will find lots of produkts labeled "without genes" in a german supermarket, which is hilarious as hell.
I guess I should make it my life goal to find some of those, then.
-
I think @faoileag should be able to show us some photos of those!
And send each of us some of them.
-
I think @faoileag should be able to show us some photos of those! And send each of us some of them.
Alas, I can't. No "gene-free" products available in our supermarkets (apart from the "toys" section).The usual disclaimer is something like "not containing ingredients that have been created using gene-altering technologies."
But I can give you a gene-free cookie:
-
not containing ingredients that have been created using gene-altering technologies
Also known as "100% of this product is artificial flavoring and preservatives".
Filed under: "untouched by evolution"
-
Also known as "100% of this product is artificial flavoring and preservatives".
But can you claim it uses no organic chemical compounds that are a result of evolutionary process?
Filed under: Think of the children!
-
On the upside, we can call it gluten free.
-
gluten free
I wouldn't count on it. http://www.celiac.com/articles/182/1/Unsafe-Gluten-Free-Food-List-Unsafe-Ingredients/Page1.html
-
no organic chemical compounds that are a result of evolutionary process?
Filed under: Creationism Ratings and Approval Program
-
Filed under: Creationism Ratings and Approval Program
Well, by their definition, it's all safe. No genes in there. Well, there are, but they were all arranged by
Jeffa perfect designer, so really, what's there to worry about?
-
what's there to worry about?
All the heathens who say/believe otherwise, because that somehow still affects our perfect food, and our lives and wellbeing will never be safe until they're all either converted or eliminated [/s]
Filed under: There are actually people who think like this
-
It backfired horribly. Back then we hated individual genes, these days we hate genes as a concept.
-
I just hate jeans, what about me?
-
Reminds me of the "Swinging Blue Genes" and their smash hit
"ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCT"
-
Liked, but disappointed GATTACA didn't end up in the letter soup.
-
Liked, but disappointed GATTACA didn't end up in the letter soup.
Oh, didn't know that one, but yes, would have fitted nicely! :-)
-
Alas, I can't. No "gene-free" products available in our supermarkets (apart from the "toys" section).
Where do you guys buy salt?
-
Where do you guys buy salt?
Prove that it is gene free.
(Proving that people who demand “gene free food” are stupid is an easy task.)
-
Prove that it is gene free.
I don't think we've discovered a sodium/chlorine-based lifeform yet.
-
Prove that it is gene free.
This sounds like a regulatory challenge. I guess I'd have to know the standards for "proving" that there are no genetically modified organisms in the food to know how to prove there were no organisms in the food. Presumably, like with bug legs or rat droppings, there's some acceptable tolerance.
Filed Under: taking things too seriously again
-
discovered ... yet.
Just because we haven't discovered it yet doesn't mean it doesn't exist. Maybe there is even intelligent life out their based on sodium/chlorine.
-
Just because we haven't discovered it yet doesn't mean it doesn't exist.
But that's probably sufficient to say it isn't in the salt at the grocery store.
-
I don't think we've discovered a sodium/chlorine-based lifeform yet.
UGLY BAGS OF MOSTLY WATER
-
Wubba Lubba Dub Dub.
-
That's easy enough: declare any non-carbon-based building blocks of live to be, say, "geanes" instead. Legally speaking, not the same thing, just like "Creme" vs "Cream".